[ensembl-dev] [VEP] Allele representation leading to strange annotation

[Konrad Karczewski]

Awesome, thanks for this!




(and for pointing me to the destroy subroutine)


-Konrad

On Thu, May 28, 2015 at 8:56 AM, Will McLaren <wm2 at ebi.ac.uk> wrote:

> Hi again Konrad,
> I added in a flag for release 80, --minimal, see
> http://www.ensembl.org/info/docs/tools/vep/script/vep_options.html#opt_minimal
> Note the caveats that reported coordinates etc may get screwed up (they
> shouldn't if you use VCF output), but if you use VCF in and out and
> --allele_number you should be able to keep track of everything OK.
> HTH
> Will
> On 16 April 2015 at 15:43, Will McLaren <wm2 at ebi.ac.uk> wrote:
>> Hi Konrad,
>>
>> Thanks for finding this.
>>
>> We'll look into a solution, though as it will involve significant code
>> refactoring, it won't be available until (at the earliest) the next
>> VEP/Ensembl release (80, due some time next month).
>>
>> In the short term you could break out the variant onto separate VCF lines,
>> though I appreciate that introduces difficulties with individual-level data.
>>
>> Regards
>>
>> Will
>>
>> On 16 April 2015 at 05:30, Konrad Karczewski <konradk at broadinstitute.org>
>> wrote:
>>
>>> Hi Will, VEP folk,
>>>
>>> Unfortunately, allele representation has bit us once again. We have the
>>> following variant:
>>>
>>> 1       3394415 .       CGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT
>>>  TGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT,C    9533.30 PASS
>>>
>>> Which is really a SNV that overlaps a larger deletion. VEP reads this
>>> as CGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT-> TGCCTCCCGGCTCTGTCCCCCCAGTCCCTCCCACTGATCTCT
>>> and since that sequence overlaps a splice acceptor (e.g. ENST00000378373),
>>> it marks it as a splice_acceptor_variant (even though it doesn't change the
>>> acceptor site - just tried VEP v79 on GRCh37 and same issue). Ideally, we'd
>>> put this through minimal representation (as we have implemented here:
>>> https://github.com/ericminikel/minimal_representation which nicely cuts
>>> the alleles down), but unfortunately inside a multi-sample VCF, this
>>> doesn't really work. Is there a way for this to happen inside VEP/is there
>>> a fix to this?
>>>
>>> Thanks!
>>> -Konrad
>>>
>>> _______________________________________________
>>> Dev mailing list    Dev at ensembl.org
>>> Posting guidelines and subscribe/unsubscribe info:
>>> http://lists.ensembl.org/mailman/listinfo/dev
>>> Ensembl Blog: http://www.ensembl.info/
>>>
>>>
>>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20150528/65ac6065/attachment.html>