[ensembl-dev] Chimp alignment for Chromosome Y
Yuan Chen
yuan at sanger.ac.uk
Tue Jan 31 20:15:37 GMT 2012
Thanks, that's great!
Yuan
On 31 Jan 2012, at 09:55, "Kathryn Beal" <kbeal at ebi.ac.uk> wrote:
> Hi Yuan,
> I can confirm that these 2 regions look correct in the new release
> (e66):
> Region 1
>
> homo_sapiens/1-1621
> TATCTCCATGGGGTCATTTTTTTTCTTTTCTTTCTTTCTCTTTTTCTTTCTTTCTTCTATTTTTTTTTTTTTTTTTTTTTTGAGACAGGATCTTGCTCTG
> pan_troglodytes/1-1621
> TATCTCCATGGGGTCATTTTTTTTCTTTTCTTTCTTTTTCTTTTTCTTTCTTTCTTCTATTTTTTTTTTTTTTTTTTT-
> --GAGACAGGATCTTGCTCTG
> *************************************
> **************************************** *******************
>
> homo_sapiens/1-1621
> TCACCCAGGCTGGAGGGCAGTGGGATGATCACTGCTCACTGCAACCCTTCACTTCTCCAAGGCTTAGGTGATCCTCCCATGATGAGGTCAATTTTTAAAG
> pan_troglodytes/1-1621
> TCACCCAGGCTGGAGGGCAGTGGGATGATCACTGCTCACTGAAACC-
> TTCACTTCTCCAAGGCTTAGGTGATCCTCCCATGATGAGGTCAATTTTTAAAG
> *****************************************
> **** *****************************************************
>
> Region 2
> homo_sapiens/1-21 TCAAGGGATCCCCAGGCTCAG
> pan_troglodytes/1-21 TCAAGGGATCCCCAGGCTCAG
> *********************
>
> Thank you for bringing this to our attention.
> Cheers
> Kathryn
>
>> Thanks Kathryn, it worked when using LASTZ_NET.
>>
>> There is slightly problem when I checked for the two regions on
>> release
>> 65:
>> region 1: Y:7387430-7387460, given human-chimp alignment :
>>
>> Homo sapiens > chromosome:GRCh37:Y:7387430:7387460:1
>> Pan troglodytes > chromosome:CHIMP2.1.4:Y:24975139:24975169:-1
>>
>> Homo sapiens TTGCTCTGTCACCCAGGCTGGAGGGCAGTGG
>> Pan troglodytes CTTGCTCTGTCACCCAGGCTGGAGGGCAGTG
>>
>> there is 1 base shift.
>>
>> region 2 : Y:13956063-13956083
>>
>> Homo sapiens > chromosome:GRCh37:Y:13956063:13956083:1
>> Pan troglodytes > chromosome:CHIMP2.1.4:1:222316894:222316914:1
>>
>> Homo sapiens TCAAGGGATCCCCAGGCTCAG
>> Pan troglodytes GGCTCAAGGGATCCCCAGGCT
>>
>> there are 3 bases shift.
>>
>> Hope this can be fixed next time.
>>
>> yuan
>>
>> On Fri, 27 Jan 2012 13:39:07 +0000, Kathryn Beal <kbeal at ebi.ac.uk>
>> wrote:
>>> Hi Yuan,
>>> The human vs chimp alignments in e65 were run using lastz instead of
>>> blastz and hence the results have a method_link type of LASTZ_NET
>>> not
>>> BLASTZ_NET.
>>>
>>> Cheers
>>> Kathryn
>>>
>>>> Hi ALL,
>>>>
>>>> I am using Ensembl Compara to pull out chimp sequences for
>> corresponding
>>>> human bases, most of them are correct, but for a few of them, I got
>>>> chimp bases that are different from human reference base, but
>>>> UCSC has
>>>> the same base as human reference base :
>>>>
>>>> Ensembl API version is 63
>>>> genomedb_name is homo_sapiens
>>>> genomedb_name is pan_troglodytes
>>>> alignment_type is BLASTZ_NET
>>>> chimp_slices is 1
>>>> num slice is 1
>>>> name of the slice is pan_troglodytes
>>>> ref_base is G and ref_pos is 2691796 and chimp base is A and
>>>> chimp_pos
>>>> is 23773099 and 1
>>>> chimp_slices is 1
>>>> num slice is 1
>>>> name of the slice is pan_troglodytes
>>>> ref_base is G and ref_pos is 2750827 and chimp base is T and
>>>> chimp_pos
>>>> is 23713497 and 2
>>>> chimp_slices is 1
>>>> num slice is 1
>>>> name of the slice is pan_troglodytes
>>>> ref_base is A and ref_pos is 2836431 and chimp base is T and
>>>> chimp_pos
>>>> is 23626512 and 3
>>>> chimp_slices is 1
>>>> num slice is 1
>>>> ..............
>>>>
>>>>
>>>> When I changed to run ensembl version 65, I got error message :
>>>>
>>>> -------------------- WARNING ----------------------
>>>> MSG: No Bio::EnsEMBL::Compara::MethodLinkSpeciesSet found for
>>>> <BLASTZ_NET> and homo_sapiens(GRCh37), pan_troglodytes(CHIMP2.1.4)
>>>> FILE: Compara/DBSQL/MethodLinkSpeciesSetAdaptor.pm LINE: 681
>>>> CALLED BY: svn/modules/AncestralBase.pm LINE: 122
>>>> Ensembl API version = 65
>>>> ---------------------------------------------------
>>>>
>>>> -------------------- EXCEPTION --------------------
>>>> MSG: [] is not a Bio::EnsEMBL::Compara::MethodLinkSpeciesSet
>>>> STACK
>>>>
>> Bio:
>> :EnsEMBL:
>> :Compara:
>> :DBSQL::AlignSliceAdaptor::fetch_by_Slice_MethodLinkSpeciesSet
>>>>
>> /nfs/team19/yuan/ensembl-checkout/ensembl-compara-65/modules/Bio/
>> EnsEMBL/Compara/DBSQL/AlignSliceAdaptor.pm:138
>>>> STACK AncestralBase::get_ancestral_allele_by_slices_from_db
>>>> /nfs/users/nfs_y/yuan/sanger/src/svn/modules/AncestralBase.pm:135
>>>> STACK main::get_base_from_pos_file ./get_ancestral_allele.pl:111
>>>> STACK toplevel ./get_ancestral_allele.pl:51
>>>> Ensembl API version = 65
>>>> ---------------------------------------------------
>>>> Ensembl API version is 65
>>>> genomedb_name is homo_sapiens
>>>> genomedb_name is pan_troglodytes
>>>> alignment_type is BLASTZ_NET
>>>>
>>>> Any idea what went wrong please?
>>>>
>>>> Thanks
>>>>
>>>> yuan_______________________________________________
>>>> Dev mailing list Dev at ensembl.org
>>>> List admin (including subscribe/unsubscribe):
>>>> http://lists.ensembl.org/mailman/listinfo/dev
>>>> Ensembl Blog: http://www.ensembl.info/
>>
>>
>> --
>> The Wellcome Trust Sanger Institute is operated by Genome Research
>> Limited, a charity registered in England with number 1021457 and a
>> company registered in England with number 2742969, whose registered
>> office is 215 Euston Road, London, NW1 2BE.
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20120131/d45da18a/attachment.html>
More information about the Dev
mailing list