[ensembl-dev] [SPAM] - Re: [SPAM] - Re: [SPAM] - Re: Transcript variation alleles - Email found in subject - Email found in subject - Email found in subject

[Will McLaren]

A variation is defined by its alleles and a pair of flanking sequence, e.g.:

ATCGTACTGTACGTGTTTATCG [A/G] TGACTTACTATCGTATGACTT

dbSNP (or in some cases Ensembl) use sequence alignment algorithms to map
this sequence to the genomic reference sequence. If it maps to the reverse
strand, we create a variation_feature on the reverse strand. In some cases
the sequence may map more than once, hence a variation object can have
multiple associated variation_feature objects. This is easier to see on the
web views:

http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=rs78197743;vdb=variation

As I mentioned, it makes our lives easier if most things are on the forward
strand, so we "flip" as many of these reverse strand mappings as we can. We
only do this when a variation has a single mapping to the reverse strand.

Will

On 2 February 2011 16:17, Oliver, Gavin <gavin.oliver at almacgroup.com> wrote:

>  Cool, thanks.
>
>
>
> What determines the strand it goes on?
>
>
>  ------------------------------
>
> *From:* wmclaren at gmail.com [mailto:wmclaren at gmail.com] *On Behalf Of *Will
> McLaren
> *Sent:* 02 February 2011 16:15
>
> *To:* Oliver, Gavin
> *Cc:* Graham Ritchie; dev at ensembl.org
> *Subject:* Re: [SPAM] - Re: [SPAM] - Re: [SPAM] - Re: [ensembl-dev]
> Transcript variation alleles - Email found in subject - Email found in
> subject - Email found in subject
>
>
>
> variation_feature objects have a strand just like all features in Ensembl -
> most are on the forward strand (as this makes our life easier!) but many are
> also on the reverse strand.
>
>
>
> As I mentioned earlier, you can check this using:
>
>
>
> $vf->seq_region_strand
>
>
>
> which will return a value of 1 (forward) or -1 (reverse).
>
> On 2 February 2011 16:09, Oliver, Gavin <gavin.oliver at almacgroup.com>
> wrote:
>
> Ok…
>
>
>
> So as it stands the alleles I am returning are genomic and called via
> variation features.  Are they always relative to the forward strand?
>
>
>
>
>
>
>  ------------------------------
>
> *From:* wmclaren at gmail.com [mailto:wmclaren at gmail.com] *On Behalf Of *Will
> McLaren
> *Sent:* 02 February 2011 16:04
> *To:* Oliver, Gavin
> *Cc:* Graham Ritchie; dev at ensembl.org
> *Subject:* [SPAM] - Re: [SPAM] - Re: [SPAM] - Re: [ensembl-dev] Transcript
> variation alleles - Email found in subject - Email found in subject - Email
> found in subject
>
>
>
> Well yes, of course it depends on what you mean!
>
>
>
> A transcript object in Ensembl represents the region of the genome that
> generates the cDNA, not the mRNA itself - this is the only thing that we'd
> be able to transfer the variation_feature object to, as I don't think there
> is an Ensembl object representing the mRNA.
>
>
>
> Will
>
> On 2 February 2011 15:54, Oliver, Gavin <gavin.oliver at almacgroup.com>
> wrote:
>
> P.S.
>
>
>
> Should it not be the other way around?
>
>
>
> i.e. if the transcript originates from the same strand as the variation
> feature then the alleles will be different?  As the transcript will be the
> reverse complement of the strand it originated on?
>
>
>
> Or have I tied my head in a knot?
>
>
>
>
>
>
>  ------------------------------
>
> *From:* wmclaren at gmail.com [mailto:wmclaren at gmail.com] *On Behalf Of *Will
> McLaren
> *Sent:* 02 February 2011 15:41
> *To:* Oliver, Gavin
> *Cc:* Graham Ritchie; dev at ensembl.org
> *Subject:* [SPAM] - Re: [SPAM] - Re: [ensembl-dev] Transcript variation
> alleles - Email found in subject - Email found in subject
>
>
>
> There is no direct method to do this (if I'm following you exactly).
>
>
>
> If the transcript is on the same strand as the variation_feature (use
> $vf->seq_region_strand and $transcript->seq_region_strand), then the
> transcript alleles will be the same; if they are different, then you will
> need to reverse complement the alleles:
>
>
>
> use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);
>
> my $new_allele_string;
>
>
>
> foreach my $allele(split /\//, $vf->allele_string) {
>
>   reverse_comp($allele);
>
>   $new_allele_string .= $allele.'/';
>
> }
>
>
>
> $new_allele_string =~ s/\/$//;
>
>
>
> We can add this functionality as $vf->transfer() if people would find it
> useful.
>
>
>
> Will
>
>
>
> On 2 February 2011 15:27, Oliver, Gavin <gavin.oliver at almacgroup.com>
> wrote:
>
> How would I go about pulling the transcriptomic one?
>
>
>  ------------------------------
>
> *From:* wmclaren at gmail.com [mailto:wmclaren at gmail.com] *On Behalf Of *Will
> McLaren
> *Sent:* 02 February 2011 15:27
> *To:* Oliver, Gavin
> *Cc:* Graham Ritchie; dev at ensembl.org
> *Subject:* Re: [SPAM] - Re: [ensembl-dev] Transcript variation alleles -
> Email found in subject
>
>
>
> In this case, as Graham says, the alleles will be the genomic alleles,
> since you are calling from a variation_feature object.
>
>
>
> Will
>
> On 2 February 2011 15:21, Oliver, Gavin <gavin.oliver at almacgroup.com>
> wrote:
>
> I’m using transcriptvariation->variation_feature->allele_string
>
>
>  ------------------------------
>
> *From:* wmclaren at gmail.com [mailto:wmclaren at gmail.com] *On Behalf Of *Will
> McLaren
> *Sent:* 02 February 2011 15:20
> *To:* Graham Ritchie
> *Cc:* Oliver, Gavin; dev at ensembl.org
> *Subject:* [SPAM] - Re: [ensembl-dev] Transcript variation alleles - Email
> found in subject
>
>
>
> Hi Gavin,
>
>
>
> What method and object type are you using to get the alleles? It's not
> clear from your email.
>
>
>
> Thanks
>
>
>
> Will
>
> On 2 February 2011 15:11, Graham Ritchie <grsr at ebi.ac.uk> wrote:
>
> Hi Gavin,
>
> The alleles of a transcript variation always represent the genomic base
> change.
>
> Cheers,
>
> Graham
>
> Ensembl variation
>
>
>
> On 2 Feb 2011, at 15:02, Oliver, Gavin wrote:
>
> > Hi,
> >
> > When I pull transcript variation alleles via the API, does the allele
> shown (e.g. A/T) represent the genomic base change, or the transcriptomic
> one?
> >
> > Gavin
> >
> >
> > The contents of this message and any attachments to it are confidential
> and may be legally privileged. If you have received this message in error,
> you should delete it from your system immediately and advise the sender.
> >
> > Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences
> Limited, registered no. NI041550. Almac Discovery Limited, registered no.
> NI046249.  Almac Pharma Services Limited, registered no. NI045055.  Almac
> Clinical Services Limited, registered no. NI041905.  Almac Clinical
> Technologies Limited, registered no. NI061202.  Almac Diagnostics Limited,
> registered no. NI043067.  All preceding companies are registered in Northern
> Ireland with a registered office address of Almac House, 20 Seagoe
> Industrial Estate, Craigavon, BT63 5QD, UK.
> >
> > Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
> >
> > Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
> Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
> Delaware limited liability companies and Almac Group Incorporated is a
> Delaware Corporation.  More information on the Almac Group can be found on
> the Almac website: www.almacgroup.com
>
> > _______________________________________________
> > Dev mailing list
> > Dev at ensembl.org
> > http://lists.ensembl.org/mailman/listinfo/dev
>
>
> _______________________________________________
> Dev mailing list
> Dev at ensembl.org
> http://lists.ensembl.org/mailman/listinfo/dev
>
>
>
> *  *
>
> The contents of this message and any attachments to it are confidential and
> may be legally privileged. If you have received this message in error, you
> should delete it from your system immediately and advise the sender.
>
>
>
> Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences Limited,
> registered no. NI041550.  Almac Discovery Limited, registered no. NI046249.
>  Almac Pharma Services Limited, registered no. NI045055.  Almac Clinical
> Services Limited, registered no. NI041905.  Almac Clinical Technologies
> Limited, registered no. NI061202.  Almac Diagnostics Limited, registered no.
> NI043067.  All preceding companies are registered in Northern Ireland with a
> registered office address of Almac House, 20 Seagoe Industrial Estate,
> Craigavon, BT63 5QD, UK.
>
>
>
> Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
>
>
>
> Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
> Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
> Delaware limited liability companies and Almac Group Incorporated is a
> Delaware Corporation.  More information on the Almac Group can be found on
> the Almac website: www.almacgroup.com
>
>
>
> *  *
>
> The contents of this message and any attachments to it are confidential and
> may be legally privileged. If you have received this message in error, you
> should delete it from your system immediately and advise the sender.
>
>
>
> Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences Limited,
> registered no. NI041550.  Almac Discovery Limited, registered no. NI046249.
>  Almac Pharma Services Limited, registered no. NI045055.  Almac Clinical
> Services Limited, registered no. NI041905.  Almac Clinical Technologies
> Limited, registered no. NI061202.  Almac Diagnostics Limited, registered no.
> NI043067.  All preceding companies are registered in Northern Ireland with a
> registered office address of Almac House, 20 Seagoe Industrial Estate,
> Craigavon, BT63 5QD, UK.
>
>
>
> Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
>
>
>
> Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
> Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
> Delaware limited liability companies and Almac Group Incorporated is a
> Delaware Corporation.  More information on the Almac Group can be found on
> the Almac website: www.almacgroup.com
>
>
>
> *  *
>
> The contents of this message and any attachments to it are confidential and
> may be legally privileged. If you have received this message in error, you
> should delete it from your system immediately and advise the sender.
>
>
>
> Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences Limited,
> registered no. NI041550.  Almac Discovery Limited, registered no. NI046249.
>  Almac Pharma Services Limited, registered no. NI045055.  Almac Clinical
> Services Limited, registered no. NI041905.  Almac Clinical Technologies
> Limited, registered no. NI061202.  Almac Diagnostics Limited, registered no.
> NI043067.  All preceding companies are registered in Northern Ireland with a
> registered office address of Almac House, 20 Seagoe Industrial Estate,
> Craigavon, BT63 5QD, UK.
>
>
>
> Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
>
>
>
> Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
> Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
> Delaware limited liability companies and Almac Group Incorporated is a
> Delaware Corporation.  More information on the Almac Group can be found on
> the Almac website: www.almacgroup.com
>
>
>
> *  *
>
> The contents of this message and any attachments to it are confidential and
> may be legally privileged. If you have received this message in error, you
> should delete it from your system immediately and advise the sender.
>
>
>
> Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences Limited,
> registered no. NI041550.  Almac Discovery Limited, registered no. NI046249.
>  Almac Pharma Services Limited, registered no. NI045055.  Almac Clinical
> Services Limited, registered no. NI041905.  Almac Clinical Technologies
> Limited, registered no. NI061202.  Almac Diagnostics Limited, registered no.
> NI043067.  All preceding companies are registered in Northern Ireland with a
> registered office address of Almac House, 20 Seagoe Industrial Estate,
> Craigavon, BT63 5QD, UK.
>
>
>
> Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
>
>
>
> Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
> Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
> Delaware limited liability companies and Almac Group Incorporated is a
> Delaware Corporation.  More information on the Almac Group can be found on
> the Almac website: www.almacgroup.com
>
>
>
> *  *
>
> The contents of this message and any attachments to it are confidential and
> may be legally privileged. If you have received this message in error, you
> should delete it from your system immediately and advise the sender.
>
>
>
> Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences
> Limited, registered no. NI041550.  Almac Discovery Limited, registered no.
> NI046249.  Almac Pharma Services Limited, registered no. NI045055.  Almac
> Clinical Services Limited, registered no. NI041905.  Almac Clinical
> Technologies Limited, registered no. NI061202.  Almac Diagnostics Limited,
> registered no. NI043067.  All preceding companies are registered in
> Northern Ireland with a registered office address of Almac House, 20 Seagoe
> Industrial Estate, Craigavon, BT63 5QD, UK.
>
>
>
> Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
>
>
>
> Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
> Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
> Delaware limited liability companies and Almac Group Incorporated is a
> Delaware Corporation.  More information on the Almac Group can be found on
> the Almac website: www.almacgroup.com
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110202/7bf10f3a/attachment.html>