[ensembl-dev] [SPAM] - Re: [SPAM] - Re: [SPAM] - Re: [SPAM] - Re: Transcript variation alleles - Email found in subject - Email found in subject - Email found in subject - Email found in subject
Oliver, Gavin
gavin.oliver at almacgroup.com
Wed Feb 2 16:43:51 GMT 2011
Thanks again Will!
________________________________
From: wmclaren at gmail.com [mailto:wmclaren at gmail.com] On Behalf Of Will
McLaren
Sent: 02 February 2011 16:32
To: Oliver, Gavin
Cc: Graham Ritchie; dev at ensembl.org
Subject: [SPAM] - Re: [SPAM] - Re: [SPAM] - Re: [SPAM] - Re:
[ensembl-dev] Transcript variation alleles - Email found in subject -
Email found in subject - Email found in subject - Email found in subject
A variation is defined by its alleles and a pair of flanking sequence,
e.g.:
ATCGTACTGTACGTGTTTATCG [A/G] TGACTTACTATCGTATGACTT
dbSNP (or in some cases Ensembl) use sequence alignment algorithms to
map this sequence to the genomic reference sequence. If it maps to the
reverse strand, we create a variation_feature on the reverse strand. In
some cases the sequence may map more than once, hence a variation object
can have multiple associated variation_feature objects. This is easier
to see on the web views:
http://www.ensembl.org/Homo_sapiens/Variation/Summary?v=rs78197743;vdb=v
ariation
As I mentioned, it makes our lives easier if most things are on the
forward strand, so we "flip" as many of these reverse strand mappings as
we can. We only do this when a variation has a single mapping to the
reverse strand.
Will
On 2 February 2011 16:17, Oliver, Gavin <gavin.oliver at almacgroup.com>
wrote:
Cool, thanks.
What determines the strand it goes on?
________________________________
The contents of this message and any attachments to it are confidential and may be legally privileged. If you have received this message in error, you should delete it from your system immediately and advise the sender.
Almac Group (UK) Limited, registered no. NI061368. Almac Sciences Limited, registered no. NI041550. Almac Discovery Limited, registered no. NI046249. Almac Pharma Services Limited, registered no. NI045055. Almac Clinical Services Limited, registered no. NI041905. Almac Clinical Technologies Limited, registered no. NI061202. Almac Diagnostics Limited, registered no. NI043067. All preceding companies are registered in Northern Ireland with a registered office address of Almac House, 20 Seagoe Industrial Estate, Craigavon, BT63 5QD, UK.
Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are Delaware limited liability companies and Almac Group Incorporated is a Delaware Corporation. More information on the Almac Group can be found on the Almac website: www.almacgroup.com
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110202/6fbc02fb/attachment.html>
More information about the Dev
mailing list