[ensembl-dev] get sequence from different build

[mailsvl at fastmail.fm]

Although it is not exactly the way I expected it to work (Hiram, your
comment of builds not always using the same contigs everywhere seems
like it could cause some incompleteness), it does what I want, thanks!
It just doesn't feel like a straight-forward approach, like fetching a
slice would: $slice_adaptor->fetch_by_region( 'chromosome', '11',
123000000, 123000020, 1, 'NCBI36' );

Thanks anyway!

-Stef


----- Original message -----
From: "Hiram Clawson" <hiram at soe.ucsc.edu>
To: "ian Longden" <ianl at ebi.ac.uk>
Cc: "Ensembl DevList" <dev at ensembl.org>
Date: Fri, 24 Sep 2010 10:25:25 -0700
Subject: Re: [ensembl-dev] get sequence from different build

FYI:  for your example position: chr11:60001-70001 in GRCh37
this translates to position: chr11:50001-60001 in build 36
All of this is on the exact same contig in both assemblies: AC069287.7

Positions will not always translate correctly.  GRCh37 and build
36 do not always use the same contigs everywhere.

--Hiram

ian Longden wrote:
> Ah yes i did my test on another region where there was sequence:-
> here is the full code and example:-
> 
> -----------------------------------------------------------------------------------------------------
> use Bio::EnsEMBL::Registry;
> my $s = 'Human';      # species-name
> my $r = 'chromosome'; # slice region
> my $c = 11;           # chromosome
> 
> 
> #my $p = 123000000;    # position
> my $p = 60001;

> ------------------------------------------------------------------------------------------------
> Giving:-
> 
> Seq for 37:-
> GAATTCTACATTAGAAAAATA
> Seq for 36:-
> AGGCAGAGGTCAAAGTGAGCC

_______________________________________________
Dev mailing list
Dev at ensembl.org
http://lists.ensembl.org/mailman/listinfo/dev

__________________
http://www.fastmail.fm