[ensembl-dev] get sequence from different build
Hiram Clawson
hiram at soe.ucsc.edu
Fri Sep 24 18:25:25 BST 2010
FYI: for your example position: chr11:60001-70001 in GRCh37
this translates to position: chr11:50001-60001 in build 36
All of this is on the exact same contig in both assemblies: AC069287.7
Positions will not always translate correctly. GRCh37 and build
36 do not always use the same contigs everywhere.
--Hiram
ian Longden wrote:
> Ah yes i did my test on another region where there was sequence:-
> here is the full code and example:-
>
> -----------------------------------------------------------------------------------------------------
> use Bio::EnsEMBL::Registry;
> my $s = 'Human'; # species-name
> my $r = 'chromosome'; # slice region
> my $c = 11; # chromosome
>
>
> #my $p = 123000000; # position
> my $p = 60001;
> ------------------------------------------------------------------------------------------------
> Giving:-
>
> Seq for 37:-
> GAATTCTACATTAGAAAAATA
> Seq for 36:-
> AGGCAGAGGTCAAAGTGAGCC
More information about the Dev
mailing list