[ensembl-dev] VEP result does not match start-end coordinate and allele for hgvs syntax

[Sarah Hunt]

Hi Bhavana,

Thanks for reporting this one - you have discovered a bug in our HGVS 
parsing of longer variants. This is now fixed in the release/85 
variation API, so if you use command line VEP, you could pick up the 
update. We are in the late stages of preparing for our next release 
which is due at the end of the month, so our REST and web servers will 
be updated then.

Best wishes,

Sarah


On 19/09/2016 10:34, Bhavana Harsha wrote:
> Hi Daniel,
>
> Thank you for this. It works on VEP REST when I reverse the coordinates.
> But from what I know reversing the coordinates is not compliant with 
> the HGVS notation rules (i.e. the positions should be listed 5’ to 3’).
>
> Besides, one of the results from Ensembl VEP (with input 
> c.783_661+1del124) is again:
>
> ENST00000460680.1:c.*661_783+1*delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG
>
> As far as I know, VEP returns HGVS compliant syntax. So, should it not 
> also accept the same as input?
>
> Cheers,
> Bhavana
>
>
>> HI Bhavana,
>>
>> I think the transcript is on the -1 strand so the start/end 
>> coordinates have to be swapped.
>> http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.783_661+1del124?content-type=application/json;canonical=1&ccds=1&hgvs=1
>>
>> But that's just a guess.
>> Best,
>> Daniel
>>
>>> From: <dev-bounces at ensembl.org<mailto:dev-bounces at ensembl.org>> on 
>>> behalf of Bhavana Harsha <bh4 at sanger.ac.uk<mailto:bh4 at sanger.ac.uk>>
>>> Reply-To: Ensembl developers list 
>>> <dev at ensembl.org<mailto:dev at ensembl.org>>
>>> Date: Friday, September 16, 2016 at 3:40 PM
>>> To: "dev at ensembl.org<mailto:dev at ensembl.org>" 
>>> <dev at ensembl.org<mailto:dev at ensembl.org>>
>>> Subject: [ensembl-dev] VEP result does not match start-end 
>>> coordinate and allele for hgvs syntax
>>>
>>> Hello,
>>>
>>> We?re trying to validate some mutations and see other co-located 
>>> variants by using the VEP REST service for GRCh37, like this:
>>>
>>> http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.661_783+1del124?content-type=application/json;canonical=1&ccds=1&hgvs=1
>>>
>>> And I get the following error:
>>> {?error":"Start (52440390) must be less than or equal to end+1 
>>> (52440270)"}
>>>
>>>
>>> If I include the deleted sequence in the hgvs syntax, I get a 
>>> different error:
>>>
>>> Input:
>>> http://grch37.rest.ensembl.org/vep/human/hgvs/ENST00000460680.1:c.661_783+1delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG?content-type=application/json;canonical=1&ccds=1&hgvs=1
>>>
>>> Output:
>>> {?error":"Reference allele extracted from 
>>> ENST00000460680:52440390-52440269 (AGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAG) 
>>> does not match reference allele given by HGVS 
>>> notation ENST00000460680.1:c.661_783+1delGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG 
>>> (GAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAAGTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCAGCAGG)"}
>>>
>>>
>>> This is strange because shouldn?t the transcript coordinates 
>>> ?ENST00000460680.1:c.661-783+1? correspond to 
>>> ?3:g.52440268-52440391?? But these aren?t the coordinates returned 
>>> and the allele sequence is inconsistent with the input.
>>>
>>> Is there something I?m missing here?
>>>
>>> Cheers,
>>> Bhavana
>>>
>>>
>>> ---------------------------------------------
>>> Bhavana Harsha
>>> Bioinformatician
>>> COSMIC
>>> Wellcome Trust Sanger Institute
>>> Hinxton, UK
>>> CB10 1SA
>
>
> _______________________________________________
> Dev mailing list    Dev at ensembl.org
> Posting guidelines and subscribe/unsubscribe info: http://lists.ensembl.org/mailman/listinfo/dev
> Ensembl Blog: http://www.ensembl.info/

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20160919/3de92f37/attachment.html>