[ensembl-dev] Different ExAC AFs for similar variants

[Will McLaren]

Hi Philip

The following line in the ExAC VCF corresponds to the first line above:

$ tabix
ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/ExAC.r0.3.1.sites.vep.vcf.gz
5:180041180-180041215 | head -n1 | cut -f 1-8 | cut -f 1-5
5       180041180       .       CTGGGGAGACAGAGGGAAGCTTGTCCCGTGGTGGA     C

The position is shifted by 1 as VCF includes the preceding base in the REF
and ALT alleles, and the sequence is reverse-complemented relative to what
you report above since FLT4 is transcribed from the reverse strand. This
also corresponds to rs753986607 [1].

The second line is a slightly longer deletion (by 1 base) which is not
found in ExAC, so a frequency is not reported.

Regards

Will McLaren
Ensembl Variation

[1] :
http://www.ensembl.org/Homo_sapiens/Variation/Explore?r=5:180613681-180614714;v=rs753986607;vdb=variation;vf=119513425



On 6 July 2016 at 18:36, Philip Jonsson <philip.jonsson at gmail.com> wrote:

> Hi,
>
> I'm using VEP for GRCh37 to annotate variants, and I'm wondering why the
> ExAC allele fractions for these two very similar variants (none of which
> corresponds to any allele observed in ExAC) differ.
> [image: Inline images 1]
> ​Thanks,
> Philip​
>
>
> _______________________________________________
> Dev mailing list    Dev at ensembl.org
> Posting guidelines and subscribe/unsubscribe info:
> http://lists.ensembl.org/mailman/listinfo/dev
> Ensembl Blog: http://www.ensembl.info/
>
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20160707/b1414eee/attachment.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: image.png
Type: image/png
Size: 26315 bytes
Desc: not available
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20160707/b1414eee/attachment.png>