[ensembl-dev] VEP (ver78) TranscriptVariationAllele.pm unitialized value error with --hgvs enabled

[Sarah Hunt]

Hi Oliver,

Thanks for reporting this one. There was an issue in identifying the 
peptides surrounding inframe insertions just before the stop codon. The 
impact was an HGVSp string like 
ENSP00000319417.5:p.412_413insCysLysArgPhe being produced rather than 
the more useful ENSP00000319417.5:p.Asn412_Ter413insCysLysArgPhe. There 
is a fix for this in branch 78 now, if you would like to pick it up from 
Github.

It's good to hear you are enjoying VEP!

Best wishes,

Sarah

On 29/01/2015 21:47, Homann, Oliver wrote:
>
> Hello,
>
> I have been using the VEP to annotate a GATK-generated VCF containing 
> indels from a WGS genotyping project, and have encountered a small 
> number of entries that result in the following error (only when –hgvs 
> is enabled):
>
>     “Use of uninitialized value in string eq at 
> /<mypath>/ensembl-tools-release-78/scripts/variant_effect_predictor/Bio/EnsEMBL/Variation/TranscriptVariationAllele.pm 
> line 1220”
>
> Here are the offending lines in the perl module:
>
>      1219   ### Convert peptide to 3 letter code as used in HGVS
>
>      1220   unless( $hgvs_notation->{ref} eq "-"){
>
>     1221       $hgvs_notation->{ref}  = 
> Bio::SeqUtils->seq3(Bio::PrimarySeq->new(-seq => 
> $hgvs_notation->{ref}, -id => 'ref',  -alphabet => 'protein')) || "";
>
>      1222   }
>
> I tracked down one of the offending entries, but it isn’t immediately 
> obvious to me why it is causing an error:
>
> #CHROM             POS        ID REF         ALT         QUAL    
> FILTER   INFO FORMAT              MySample
>
> 13           21729289 .               T 
> TCAGTTTTCTTTGTTGCTGACATCTCGGATGTTCTGTCCATGTTTAAGGAACCTTTTA 118.19   . 
> AC=1;AF=5.556e-03;AN=180;BaseQRankSum=0.744;DP=2652;FS=3.538;GQ_MEAN=66.68;GQ_STDDEV=20.39;InbreedingCoeff=-0.0085;MLEAC=1;MLEAF=5.556e-03;MQ=60.00;MQ0=0;MQRankSum=0.609;NCC=0;QD=0.13;ReadPosRankSum=-1.220e-01;SOR=0.252 
> GT:AD:DP:GQ:PL              0/1:41,8:.:99:160,0,14558
>
> Any ideas what the problem might be?
>
> Thanks,
>
> Oliver Homann
>
> P.S.  Apart from this small glitch, VEP is teriffic!
>
>
>
> _______________________________________________
> Dev mailing list    Dev at ensembl.org
> Posting guidelines and subscribe/unsubscribe info: http://lists.ensembl.org/mailman/listinfo/dev
> Ensembl Blog: http://www.ensembl.info/

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20150130/0bc98b18/attachment.html>