[ensembl-dev] newbie with Ensembl API- alignments

[Stephen Fitzgerald]

Hi Manuel, you can also try our REST service, which will give you the 
option of accessing the data (output in JSON format) in a number of ways:
http://beta.rest.ensembl.org/documentation/info/genomic_alignment_block_region
for example (using human coords 19:7184302-7184344):
bash> curl 'http://beta.rest.ensembl.org/alignment/block/region/homo_sapiens/19:7184302-7184344:1?species_set_group=primates' -H 'Content-type:application/json'

Also, if you wish to use the perl API, here is a script for retrieving the 
alignments in phylip format:
bash> perl script.pl > out.phylip

################ script.pl

use strict;
use warnings;
use Data::Dumper;
use Bio::AlignIO;

use Bio::EnsEMBL::Registry;

#Auto-configure the registry
Bio::EnsEMBL::Registry->load_registry_from_db(
         -host=>"ensembldb.ensembl.org", -user=>"anonymous",
         -port=>'5306', db_version => 74);


# Get the Compara Adaptor for MethodLinkSpeciesSets
my $method_link_species_set_adaptor =
     Bio::EnsEMBL::Registry->get_adaptor(
       "Multi", "compara", "MethodLinkSpeciesSet");

my $methodLinkSpeciesSet = $method_link_species_set_adaptor->
         fetch_by_method_link_type_species_set_name("EPO", "primates");

# Define the start and end positions for the alignment
my ($ref_start, $ref_end) = (7184302, 7184344);

# Get the reference species *core* Adaptor for Slices
my $ref_slice_adaptor =
     Bio::EnsEMBL::Registry->get_adaptor(
       "homo_sapiens", "core", "Slice");

# Get the slice corresponding to the region of interest
my $ref_slice = $ref_slice_adaptor->fetch_by_region(
     "chromosome", 19, $ref_start, $ref_end);

# Get the Compara Adaptor for GenomicAlignBlocks
my $genomic_align_block_adaptor =
     Bio::EnsEMBL::Registry->get_adaptor(
       "Multi", "compara", "GenomicAlignBlock");

# The fetch_all_by_MethodLinkSpeciesSet_Slice() returns a ref.
# to an array of GenomicAlingBlock objects (human is the reference species)
my $all_genomic_align_blocks = $genomic_align_block_adaptor->
     fetch_all_by_MethodLinkSpeciesSet_Slice(
         $methodLinkSpeciesSet, $ref_slice);

# set up an AlignIO to format SimpleAlign output
my $alignIO = Bio::AlignIO->newFh(-interleaved => 0,
                                   -fh => \*STDOUT,
                                   -format => 'phylip',
                                   -idlength => 30);

# print the restricted alignments
foreach my $genomic_align_block( @{ $all_genomic_align_blocks }) {
         my $restricted_gab = 
$genomic_align_block->restrict_between_reference_positions($ref_start, 
$ref_end);
         print $alignIO $restricted_gab->get_SimpleAlign;
}

################ out.phylip
  6 44
homo_sapiens/19               cccc-agacccacatccagaactcacttgctggaattcatcgtg
pongo_abelii/19               cccc-agacctacatccagaactcacttgctggaattcatcgtg
pan_troglodytes/19            cccc-agacccacaaccagaactcacttgctggaattcatcgtg
gorilla_gorilla/19            cccc-agacccacatctagaactcacttgctggaattcatcgtg
callithrix_jacchus/22         ccccaagacccacatgcaggactcacttgctggaattcatcgtg
macaca_mulatta/19             cccc-ggacccacatacagaactcacttgctggaattcatcgtg


Cheers,
Stephen.



On Mon, 13 Jan 2014, Emily Pritchard wrote:

> Hi Manuel
> 
> Have you seen our API course on EBI Train Online:
> http://www.ebi.ac.uk/training/online/course/ensembl-filmed-api-workshop
> 
> The Core section will introduce you to the API itself, and the Compara module for alignments.
> 
> Hope this helps
> 
> Emily
> 
> On 13/01/2014 13:32, Manuel Rodríguez Pascual wrote:
>       I am just starting working with Ensembl API. I am not really experienced neither with Ensembl or bioinformatics itself,so I am stuck
>       in a problem that seems to be easy to solve.
> 
> 
> As a test and proof of concept, I am interested to retrieve information of a comparison in phylip format. In particular, the provided
> example
> http://www.ensembl.org/Homo_sapiens/Gene/Compara_Alignments?align=548&db=core&g=ENSG00000171105&r=19%3A7112266-7294045
> 
> when exported into a phylip format, 
> 
> http://www.ensembl.org/Homo_sapiens/Export/Output/Location/Alignment?align=548;db=core;g=ENSG00000171105;output=alignment;r=19:7112266-7294045;
> format=phylip;_format=Text
> 
> I have however seen that the employment of wget is discouraged and the Ensembl API should be used instead.
> 
> Reading the available documentation, I fell that I should use the Compara API Tutorial, 
> http://www.ensembl.org/info/docs/api/compara/compara_tutorial.html
> 
> but I don't really understand it or how to apply it to my objective.
> 
> The question is, can anyone orient me on how to proceed? 
> 
> 
> 
> Thanks for your attention,
> 
> 
> 
> Manuel 
> 
> 
> -- 
> Dr. Manuel Rodríguez-Pascual
> skype: manuel.rodriguez.pascual
> phone: (+34) 913466173 // (+34) 679925108
>  
> CIEMAT-Moncloa
> Edificio 22, desp. 1.25
> Avenida Complutense, 40 
> 28040- MADRID
> SPAIN
> 
> 
> _______________________________________________
> Dev mailing list    Dev at ensembl.org
> Posting guidelines and subscribe/unsubscribe info: http://lists.ensembl.org/mailman/listinfo/dev
> Ensembl Blog: http://www.ensembl.info/
> 
> 
> -- 
> Dr Emily Pritchard
> Ensembl Outreach Officer
> 
> European Bioinformatics Institute (EMBL-EBI)
> European Molecular Biology Laboratory
> Wellcome Trust Genome Campus
> Hinxton
> Cambridge
> CB10 1SD
> UK 
> 
>