[ensembl-dev] Problem with biomaRt::getSequence
Mohammad Tanvir Ahamed
mashranga at yahoo.com
Wed May 8 16:28:03 BST 2013
Hi Rhoda,
Thank for your help .
Now the following code is working.
ensembl = useMart("ENSEMBL_MART_ENSEMBL",dataset="hsapiens_gene_ensembl",host="www.ensembl.org/biomart/martservice/")
getBM(attributes=c("peptide","entrezgene"),filters="entrezgene",values=c("5728","100"),mart=ensembl)
/.......Tanvir Ahamed
>________________________________
> From: Rhoda Kinsella <rhoda at ebi.ac.uk>
>To: Mohammad Tanvir Ahamed <mashranga at yahoo.com>
>Cc: Ensembl developers list <dev at ensembl.org>
>Sent: Wednesday, 8 May 2013, 14:58
>Subject: Re: [ensembl-dev] Problem with biomaRt::getSequence
>
>
>
>Hi Tanvir Ahamed,
>If you add a forward slash (/) at the end of host="www.ensembl.org/biomart/martview" it will work.
>
>
>
>
>> listMarts(host="www.ensembl.org/biomart/martservice/")
> biomart version
>1 ENSEMBL_MART_ENSEMBL Ensembl Genes 71
>2 ENSEMBL_MART_SNP Ensembl Variation 71
>3 ENSEMBL_MART_FUNCGEN Ensembl Regulation 71
>4 ENSEMBL_MART_VEGA Vega 51
>5 REACTOME REACTOME (CSHL US)
>6 pride PRIDE (EBI UK)
>
>
>
>
>Hope that helps
>Regards
>Rhoda
>
>
>
>
>On 8 May 2013, at 13:49, Mohammad Tanvir Ahamed <mashranga at yahoo.com> wrote:
>
>Hi Rhoda,
>>Thank for your reply.
>>I have also mail this problem to BioMart mail list and waiting for reply .
>>According to your suggestion , When i run the commend i get the following error
>>
>>
>>> ensembl = useMart("ensembl",dataset="hsapiens_gene_ensembl",host="www.ensembl.org/biomart/martview")
>>
>>
>>Entity 'nbsp' not defined
>>Entity 'hellip' not defined
>>Entity 'hellip' not defined
>>Entity 'hellip' not defined
>>Entity 'hellip' not defined
>>Entity 'hellip' not defined
>>Entity 'hellip' not defined
>>Entity 'hellip' not defined
>>Entity 'nbsp' not defined
>>Entity 'nbsp' not defined
>>Entity 'copy' not defined
>>Entity 'nbsp' not defined
>>Entity 'nbsp' not defined
>>Entity 'nbsp' not defined
>>Error: 1: Entity 'nbsp' not defined
>>2: Entity 'hellip' not defined
>>3: Entity 'hellip' not defined
>>4: Entity 'hellip' not defined
>>5: Entity 'hellip' not defined
>>6: Entity 'hellip' not defined
>>7: Entity 'hellip' not defined
>>8: Entity 'hellip' not defined
>>9: Entity 'nbsp' not defined
>>10: Entity 'nbsp' not defined
>>11: Entity 'copy' not defined
>>12: Entity 'nbsp' not defined
>>13: Entity 'nbsp' not defined
>>14: Entity 'nbsp' not defined
>>
>>/.......Tanvir Ahamed
>>
>>
>>
>>>________________________________
>>> From: Rhoda Kinsella <rhoda at ebi.ac.uk>
>>>To: Mohammad Tanvir Ahamed <mashranga at yahoo.com>; Ensembl developers list <dev at ensembl.org>
>>>Sent: Wednesday, 8 May 2013, 14:05
>>>Subject: Re: [ensembl-dev] Problem with biomaRt::getSequence
>>>
>>>
>>>
>>>Hi Tanvir Ahamed,
>>>I suspect that you are running your biomaRt query against the BioMart central portal at www.biomart.org which the Ensembl project is not responsible for maintaining. Can you try setting your host to http://www.ensembl.org/biomart/martview/ and let me know if you have the same issue? For any www.biomart.org issues you should email their mailing list (users at biomart.org).
>>>Regards
>>>Rhoda
>>>
>>>
>>>On 8 May 2013, at 12:16, Mohammad Tanvir Ahamed <mashranga at yahoo.com> wrote:
>>>
>>>Hi,
>>>>I can run the code some days ago . But cant run now.
>>>>
>>>>
>>>>Problem 1: Output is ok
>>>>ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
>>>>utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl)
>>>>Output :
>>>> 5utr entrezgene
>>>> Sequence unavailable 10644
>>>> GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644
>>>>3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644
>>>> CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644
>>>> No UTR is annotated for this transcript 10644
>>>>
>>>>Problem 2:Problem is here
>>>>
>>>>protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)
>>>>
>>>>
>>>>Error in getBM(c(seqType, type), filters = type, values = id, mart = mart, :
>>>> Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
>>>>
>>>>
>>>>I need help please.
>>>>
>>>>/.......Tanvir Ahamed
>>>>_______________________________________________
>>>>Dev mailing list Dev at ensembl.org
>>>>Posting guidelines and subscribe/unsubscribe info: http://lists.ensembl.org/mailman/listinfo/dev
>>>>Ensembl Blog: http://www.ensembl.info/
>>>>
>>>
>>>Rhoda Kinsella Ph.D.
>>>Ensembl Production Project Leader,
>>>European Bioinformatics Institute (EMBL-EBI),
>>>Wellcome Trust Genome Campus,
>>>Hinxton,
>>>Cambridge,
>>>CB10 1SD
>>>
>>>
>>>
>>>
>>>
>>>
>
>Rhoda Kinsella Ph.D.
>Ensembl Production Project Leader,
>European Bioinformatics Institute (EMBL-EBI),
>Wellcome Trust Genome Campus,
>Hinxton,
>Cambridge,
>CB10 1SD
>
>
>
>
>
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20130508/eaa0a4c3/attachment.html>
More information about the Dev
mailing list