[ensembl-dev] Problem with biomaRt::getSequence

[Rhoda Kinsella]

Hi Tanvir Ahamed,
I suspect that you are running your biomaRt query against the BioMart central portal at www.biomart.org which the Ensembl project is not responsible for maintaining. Can you try setting your host to http://www.ensembl.org/biomart/martview/ and let me know if you have the same issue? For any www.biomart.org issues you should email their mailing list (users at biomart.org).
Regards
Rhoda

On 8 May 2013, at 12:16, Mohammad Tanvir Ahamed <mashranga at yahoo.com> wrote:

> Hi,
> I can run the code some days ago . But cant run now. 
> 
> Problem 1: Output is ok
> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, type="entrezgene",seqType="5utr", mart=ensembl) 
> Output : 
>                                                                                               5utr  entrezgene
>                                                                              Sequence unavailable      10644
>                                              GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
> 3 GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>                                  CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>                                                          No UTR is annotated for this transcript      10644
>  
> Problem 2:Problem is here
> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", mart=ensembl)
> 
> Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
>   Query ERROR: caught BioMart::Exception::Database: Error during query execution: Can't create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
> 
> I need help please.
>  
> /.......Tanvir Ahamed
> _______________________________________________
> Dev mailing list    Dev at ensembl.org
> Posting guidelines and subscribe/unsubscribe info: http://lists.ensembl.org/mailman/listinfo/dev
> Ensembl Blog: http://www.ensembl.info/

Rhoda Kinsella Ph.D.
Ensembl Production Project Leader,
European Bioinformatics Institute (EMBL-EBI),
Wellcome Trust Genome Campus,
Hinxton,
Cambridge,
CB10 1SD



-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20130508/343cd94d/attachment.html>