[ensembl-dev] Rendering deletions in BAM files
Fedor Gusev
gusevfe at gmail.com
Thu Sep 1 09:45:52 BST 2011
Cigar string: 15M23D86M
Here is the extract from our BAM file:
HWI-ST150_0130:8:22:1406:191742#0 163 1 924162 70
15M23D86M = 924458 396
CTGGAGTTCAGGGTTGAGTGTTTCGGGAGTTCTGGGTTGATTGTTTCTNGGGTTCAGGGTTGATTGTTTCTGGAGTTCAGGGTTGATTATTTCTGGTGTTT
=EFHCF<@F>FFF=@FAG=F>@@F<EEAF=?EDFEE=@F@@@E=@@AC*@<A;><>CEE<?E<=><:??5EB<@F=?2*8972:6<;=6.??=0-(---,*
X0:i:1 X1:i:0 OC:Z:101M RG:Z:S000007 XG:i:0 AM:i:37
NM:i:25 SM:i:37 XM:i:4 XO:i:0 OP:i:924185 MQ:i:60
OQ:Z:ffffffdffffffeffcfdfefffceebebeeededdff`fecceb``Ba[aYa\aaddacbY\`XYaaVd^\`daaTKT[WMYS[Y^UK``^BBBBBBBB
XT:A:U
Attached are renders from Ensembl (with and without patch) and the
same read rendered by IGV.
On Wed, Aug 31, 2011 at 7:36 AM, Steve Searle <searle at sanger.ac.uk> wrote:
> Hi Fedor
>
> I'm looking at your patch. Could you send me some examples of cigar strings
> you think are being handled wrong, or a very small test bam file, to allow
> me to reproduce the problem.
>
> Thanks and Regards
>
> Steve
>
> On 30 Aug 2011, at 09:06, Fedor Gusev wrote:
>
>> Hello.
>>
>> I think BAM rendering code has an error. Basically, the cigar string
>> is threated the wrong way. It has the form ([0-9]*[MDISN])* while code
>> assumes ([MDISN][0-9]*)* . This results in everything being threated
>> as match and no deletions are shown.
>>
>> Attach patch fixes it.
>>
>> --
>> Kind regards,
>> Fedor Gusev.
>> <bam.patch>_______________________________________________
>> Dev mailing list Dev at ensembl.org
>> List admin (including subscribe/unsubscribe):
>> http://lists.ensembl.org/mailman/listinfo/dev
>> Ensembl Blog: http://www.ensembl.info/
>
>
>
> --
> The Wellcome Trust Sanger Institute is operated by Genome ResearchLimited, a
> charity registered in England with number 1021457 and acompany registered in
> England with number 2742969, whose registeredoffice is 215 Euston Road,
> London, NW1 2BE.
--
Kind regards,
Fedor Gusev.
-------------- next part --------------
A non-text attachment was scrubbed...
Name: wrong-bam.png
Type: image/png
Size: 1267 bytes
Desc: not available
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110901/baf47d27/attachment.png>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: right-bam.png
Type: image/png
Size: 1891 bytes
Desc: not available
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110901/baf47d27/attachment-0001.png>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: igv.png
Type: image/png
Size: 455 bytes
Desc: not available
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110901/baf47d27/attachment-0002.png>
More information about the Dev
mailing list