[ensembl-dev] Funcgen array mapping - Probeset with strange annotation result

[Oliver, Gavin]

Bearing in mind that there are no unmapped objects Nathan, have you any
other ideas what might be happening here?

 

Do you think there's an easy way I could run exonerate just for these 11
probes to inspect the output?

 

Gavin

 

________________________________

From: Nathan Johnson [mailto:njohnson at ebi.ac.uk] 
Sent: 13 January 2011 16:17
To: Oliver, Gavin
Cc: dev at ensembl.org
Subject: Re: [ensembl-dev] Funcgen array mapping - Probeset with strange
annotation result

 

Hi Gavin

 

Not having mapped this probe set myself, I can't really tell what's
going on.  Have you tried looking at the unmapped objects for these
probes?  It could be that the other are 'promiscuous'.

 

Nath

 

 

 

On 12 Jan 2011, at 11:04, Oliver, Gavin wrote:





Hi all,

 

One of our users has pointed out a probeset (affy utr format) that seems
to be retrieving some unexpected annotation info via the FuncGen array
mapping environment.

 

The probeset annotates to ENSG00000140853  but only seems to return
probe features for four probes i.e. the end result says 4/11 probes
align.  However when I look at the alignment manually using Ensembl or
NCBI it looks like all probes align.  

 

To try and ensure that my scripts aren't doing anything funny, I set up
a quick test like this:

 

my @probes = @{$probeset->get_all_Probes};

 

        foreach my $probe (@probes) {

                my @probefeatures = @{$probe->get_all_ProbeFeatures()};

                foreach my $feature(@probefeatures) {

                        print $feature->probe_id."\n";

                }

        }

 

And sure enough only 4 probe IDs are returned.

 

The probes look like this:

 

>probe:ADXBRCv2a520413:BRRS.12588_at:1019:477;
Interrogation_Position=313; Antisense;

CCTGCCCTGGAAGTAATCTTGCTGT

>probe:ADXBRCv2a520413:BRRS.12588_at:852:123;
Interrogation_Position=324; Antisense;

AGTAATCTTGCTGTCCTGGAATCTC

>probe:ADXBRCv2a520413:BRRS.12588_at:665:993;
Interrogation_Position=329; Antisense;

TCTTGCTGTCCTGGAATCTCCTCGG

>probe:ADXBRCv2a520413:BRRS.12588_at:295:809;
Interrogation_Position=353; Antisense;

GGGATGAGGCAGCTGCCGAGCTGGC

>probe:ADXBRCv2a520413:BRRS.12588_at:921:949;
Interrogation_Position=383; Antisense;

TGCTGCCGAAGATGGGCCGGCTGAA

>probe:ADXBRCv2a520413:BRRS.12588_at:1130:813;
Interrogation_Position=478; Antisense;

GGGTCTAGCATCCAAGTCATCCGCC

>probe:ADXBRCv2a520413:BRRS.12588_at:411:539;
Interrogation_Position=485; Antisense;

GCATCCAAGTCATCCGCCTCTGGAA

>probe:ADXBRCv2a520413:BRRS.12588_at:94:315; Interrogation_Position=491;
Antisense;

AAGTCATCCGCCTCTGGAATAACCC

>probe:ADXBRCv2a520413:BRRS.12588_at:307:341;
Interrogation_Position=508; Antisense;

AATAACCCCATTCCCTGCGACATGG

>probe:ADXBRCv2a520413:BRRS.12588_at:553:511;
Interrogation_Position=524; Antisense;

GCGACATGGCCCAGCACCTGAAGAG

>probe:ADXBRCv2a520413:BRRS.12588_at:1099:419;
Interrogation_Position=567; Antisense;

CTTTGCCTTCTTTGACAACCAGCCC

 

 

Can anyone suggest what might be happening?

 

Best,

 

Gavin

 

 

The contents of this message and any attachments to it are confidential
and may be legally privileged. If you have received this message in
error, you should delete it from your system immediately and advise the
sender.

 

Almac Group (UK) Limited, registered no. NI061368.  Almac Sciences
Limited, registered no. NI041550.  Almac Discovery Limited, registered
no. NI046249.  Almac Pharma Services Limited, registered no. NI045055.
Almac Clinical Services Limited, registered no. NI041905.  Almac
Clinical Technologies Limited, registered no. NI061202.  Almac
Diagnostics Limited, registered no. NI043067.  All preceding companies
are registered in Northern Ireland with a registered office address of
Almac House, 20 Seagoe Industrial Estate, Craigavon, BT63 5QD, UK.  

 

Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.

 

Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac
Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are
Delaware limited liability companies and Almac Group Incorporated is a
Delaware Corporation.  More information on the Almac Group can be found
on the Almac website: www.almacgroup.com

_______________________________________________
Dev mailing list
Dev at ensembl.org
http://lists.ensembl.org/mailman/listinfo/dev

 

Nathan Johnson

Scientific Programmer

European Bioinformatics Institute

Wellcome Trust Genome Campus

Hinxton

Cambridge CB10 1SD

Email: njohnson at ebi.ac.uk

TelNo: (+44)1223 492629

 

 





 

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110118/b2602056/attachment.html>