[ensembl-dev] Funcgen array mapping - Probeset with strange annotation result
Nathan Johnson
njohnson at ebi.ac.uk
Thu Jan 13 16:17:22 GMT 2011
Hi Gavin
Not having mapped this probe set myself, I can't really tell what's going on. Have you tried looking at the unmapped objects for these probes? It could be that the other are 'promiscuous'.
Nath
On 12 Jan 2011, at 11:04, Oliver, Gavin wrote:
> Hi all,
>
> One of our users has pointed out a probeset (affy utr format) that seems to be retrieving some unexpected annotation info via the FuncGen array mapping environment.
>
> The probeset annotates to ENSG00000140853 but only seems to return probe features for four probes i.e. the end result says 4/11 probes align. However when I look at the alignment manually using Ensembl or NCBI it looks like all probes align.
>
> To try and ensure that my scripts aren’t doing anything funny, I set up a quick test like this:
>
> my @probes = @{$probeset->get_all_Probes};
>
> foreach my $probe (@probes) {
> my @probefeatures = @{$probe->get_all_ProbeFeatures()};
> foreach my $feature(@probefeatures) {
> print $feature->probe_id."\n";
> }
> }
>
> And sure enough only 4 probe IDs are returned.
>
> The probes look like this:
>
> >probe:ADXBRCv2a520413:BRRS.12588_at:1019:477; Interrogation_Position=313; Antisense;
> CCTGCCCTGGAAGTAATCTTGCTGT
> >probe:ADXBRCv2a520413:BRRS.12588_at:852:123; Interrogation_Position=324; Antisense;
> AGTAATCTTGCTGTCCTGGAATCTC
> >probe:ADXBRCv2a520413:BRRS.12588_at:665:993; Interrogation_Position=329; Antisense;
> TCTTGCTGTCCTGGAATCTCCTCGG
> >probe:ADXBRCv2a520413:BRRS.12588_at:295:809; Interrogation_Position=353; Antisense;
> GGGATGAGGCAGCTGCCGAGCTGGC
> >probe:ADXBRCv2a520413:BRRS.12588_at:921:949; Interrogation_Position=383; Antisense;
> TGCTGCCGAAGATGGGCCGGCTGAA
> >probe:ADXBRCv2a520413:BRRS.12588_at:1130:813; Interrogation_Position=478; Antisense;
> GGGTCTAGCATCCAAGTCATCCGCC
> >probe:ADXBRCv2a520413:BRRS.12588_at:411:539; Interrogation_Position=485; Antisense;
> GCATCCAAGTCATCCGCCTCTGGAA
> >probe:ADXBRCv2a520413:BRRS.12588_at:94:315; Interrogation_Position=491; Antisense;
> AAGTCATCCGCCTCTGGAATAACCC
> >probe:ADXBRCv2a520413:BRRS.12588_at:307:341; Interrogation_Position=508; Antisense;
> AATAACCCCATTCCCTGCGACATGG
> >probe:ADXBRCv2a520413:BRRS.12588_at:553:511; Interrogation_Position=524; Antisense;
> GCGACATGGCCCAGCACCTGAAGAG
> >probe:ADXBRCv2a520413:BRRS.12588_at:1099:419; Interrogation_Position=567; Antisense;
> CTTTGCCTTCTTTGACAACCAGCCC
>
>
> Can anyone suggest what might be happening?
>
> Best,
>
> Gavin
>
>
> The contents of this message and any attachments to it are confidential and may be legally privileged. If you have received this message in error, you should delete it from your system immediately and advise the sender.
>
> Almac Group (UK) Limited, registered no. NI061368. Almac Sciences Limited, registered no. NI041550. Almac Discovery Limited, registered no. NI046249. Almac Pharma Services Limited, registered no. NI045055. Almac Clinical Services Limited, registered no. NI041905. Almac Clinical Technologies Limited, registered no. NI061202. Almac Diagnostics Limited, registered no. NI043067. All preceding companies are registered in Northern Ireland with a registered office address of Almac House, 20 Seagoe Industrial Estate, Craigavon, BT63 5QD, UK.
>
> Almac Sciences (Scotland) Limited, registered in Scotland no. SC154034.
>
> Almac Clinical Services LLC, Almac Clinical Technologies LLC, Almac Diagnostics LLC, Almac Pharma Services LLC and Almac Sciences LLC are Delaware limited liability companies and Almac Group Incorporated is a Delaware Corporation. More information on the Almac Group can be found on the Almac website: www.almacgroup.com
> _______________________________________________
> Dev mailing list
> Dev at ensembl.org
> http://lists.ensembl.org/mailman/listinfo/dev
Nathan Johnson
Scientific Programmer
European Bioinformatics Institute
Wellcome Trust Genome Campus
Hinxton
Cambridge CB10 1SD
Email: njohnson at ebi.ac.uk
TelNo: (+44)1223 492629
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20110113/cca63322/attachment.html>
More information about the Dev
mailing list