[ensembl-dev] Variant Consequence Predictor

[Stuart Meacham]

On 25/02/11 10:26, Laura Clarke wrote:
> The dbsnp page for this site would suggest this is a strand issue
>
> http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?searchType=adhoc_search&type=rs&rs=rs79525962
> ss126705640	1000GENOMES|SRP_031_6362630_chr11_76049066	byFreq	fwd/B	C/T	ggttgagccgctgcaggctggccagattgg	aaaggtgtatgggggcaggtcccgcagggc	04/18/09	03/08/10	131	Genomic			unknown
> ss161043141	ILLUMINA|HumanOmni1-Quad_v1-0_B_SNP11-76049066-128_T_R_1587991382		rev/T	A/G	gccctgcgggacctgcccccatacaccttt	ccaatctggccagcctgcagcggctcaacc	08/04/09	10/05/09	131	Genomic			unknown
> ss168944051	ILLUMINA|Human1M-Duov3_B_GA010171-0_T_R_1533432755		rev/T	A/G	gccctgcgggacctgcccccatacaccttt	ccaatctggccagcctgcagcggctcaacc	10/01/09	10/01/09	132	Genomic			unknown
> ss202899005	BUSHMAN|BUSHMAN-chr11-76049065		fwd/	C/G	ggttgagccgctgcaggctggccagattgg	aaaggtgtatgggggcaggtcccgcagggc	02/16/10	03/08/10	132	Genomic			unknown
> ss235617451	1000GENOMES|pilot_1_CEU_5222080_chr11_76049066		fwd/	C/T	ggttgagccgctgcaggctggccagattgg	aaaggtgtatgggggcaggtcccgcagggc	05/01/10	05/01/10	132	Genomic			unknown
> ss242238239	1000GENOMES|pilot_1_CHB+JPT_4123316_chr11_76049066		fwd/	C/T	ggttgagccgctgcaggctggccagattgg	aaaggtgtatgggggcaggtcccgcagggc	05/01/10	05/01
>
> The C/T ss ids are all forward strand but the A/G ones are reverse strand
>
> The transcript itself is on the reverse strand
>
> http://www.ensembl.org/Homo_sapiens/Transcript/Summary?db=core;g=ENSG00000137507;r=11:76368568-76381791;t=ENST00000260061;v=rs79525962;vdb=variation;vf=1164142
>
> which means for the transcript the correct consequence is
> rs79525962 407 C T A/P NON_SYNONYMOUS_CODING


Does this mean that when passed a VCF any consequence prediction for a 
Transcript on the reverse strand is possibly incorrect!? This would be 
misleading as the script actually returns the transcript on which the 
SNP and consequence are predicted to effect . . .

Stuart