[ensembl-dev] Core API quits with no error messages
Damian
dfermin at umich.edu
Fri Aug 26 19:46:20 BST 2011
Well it looks like you were right.
I reloaded version 62 from scratch and it works now.
Close this ticket!!
Thanks!!
Damian
On 08/26/2011 11:00 AM, ian Longden wrote:
> On Fri, Aug 26, 2011 at 3:46 PM, Damian<dfermin at umich.edu> wrote:
>> I changed the registry settings to point it to ensembldb.ensembl.org and
>> Version 62 worked. I got the same things you did.
>> I set the registry settings back to our local host and the problem
>> reappeared.
>>
>> So should I reinstall the API or reinstall version 62 core?
> hmmm.
> The API obviously works as you can get data from the ensembl site. So
> it might be worth
> reinstalling 62 version of core for human.
>
> It might be worth having a quick look at your internal database and
> compare counts for a few tables between that and the ensembl version.
>
> i.e.
> mysql -hensembldb.ensembl.org -uanonymous -P5306
> homo_sapiens_core_62_37g -e 'select count(1) from exon'
> +----------+
> | count(1) |
> +----------+
> | 1128110 |
> +----------+
>
> try this for a few tables like gene, transcript, dna, seq_region,
> exon_transcript..
>
> Just to make sure it is this but it might be quicker just to reinstall..
>
> -Ian.
>
>> Damian
>>
>>
>> On 08/26/2011 10:39 AM, ian Longden wrote:
>>> Change 63 to 62.
>>> I did this and got:-
>>>
>>>> ENSE00002226834
>>>
>>> CTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCACCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACG
>>>
>>>> ENSE00002270664
>>>
>>> CAACAGTGCGCCCGGGGGGCCTGACCCCGACCACCGCATATACCAGCAAAGATGCGCCCGGGGGCCTGACCCCGACCACCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCACCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAAAGGTGCGCCCGGGGGCCT
>>>
>>>> ENSE00002216223
>>>
>>> CAACGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAAAG
>>>
>>>
>>> I am guessing you have 62 version of the API installed, in which case
>>> if you do not set a db_version, you will automatically load the 62
>>> databases.
>>>
>>> So try two things 1) connect to our server to see if that works okay
>>> 2) connect to your local copy and see if it
>>> works
>>>
>>> This will hopefully tell us if there is a problem with your local copy
>>> or wether the API is wrong at your end.
>>>
>>> -Ian.
>>>
>>>
>>> -Ian
>>>
>>>
>>>
>>> On Fri, Aug 26, 2011 at 3:27 PM, Damian<dfermin at umich.edu> wrote:
>>>> Hi Ian.
>>>> Thanks for the quick reply.
>>>>
>>>> I'm using Ensembl Human Core 62_37g.
>>>>
>>>> We have to stick to this version because all our previous work was done
>>>> with
>>>> it.
>>>>
>>>> Your code changes do indeed work but only with the 63 release.
>>>> Is there a way to identify these problem cases in 62 and to skip them?
>>>>
>>>> if(defined($gene)) doesn't work for me since the gene object is indeed
>>>> returned.
>>>>
>>>> Damian
>>>>
>>>>
>>>>
>>>> On 08/26/2011 10:16 AM, ian Longden wrote:
>>>>> What version of the API are you using?
>>>>> ENSG00000256461 has been archived and is not in release 63 so that
>>>>> could be part of it.
>>>>>
>>>>> also add -verbose => 1 to the load_registry_form_db to see which
>>>>> databases it is connecting to.
>>>>>
>>>>> So i modified your script to use our server as a test
>>>>> #######################################################
>>>>> use Bio::EnsEMBL::Registry;
>>>>>
>>>>> my $reg = 'Bio::EnsEMBL::Registry';
>>>>>
>>>>> $reg->load_registry_from_db(
>>>>> -host => 'ensembldb.ensembl.org',
>>>>> -user => 'anonymous',
>>>>> -db_version => 63,
>>>>> -verbose => 1
>>>>> );
>>>>>
>>>>>
>>>>> my $GA = $reg->get_adaptor('Human', 'Core', 'Gene');
>>>>>
>>>>> my $gene = $GA->fetch_by_stable_id('ENSG00000256461');
>>>>>
>>>>> if(defined($gene)){
>>>>>
>>>>> my @exons = @{ $gene->get_all_Exons() };
>>>>>
>>>>> foreach my $e (@exons) {
>>>>> print ">" . $e->stable_id() . "\n";
>>>>> print $e->seq->seq . "\n\n";
>>>>> }
>>>>> }
>>>>> else{
>>>>> print "Gene could not be found\n";
>>>>> }
>>>>>
>>>>> exit;
>>>>> ##################################################################
>>>>> which gave me the list of databases and also the message:-
>>>>> Gene could not be found
>>>>>
>>>>> -Ian Longden
>>>>> EnsEMBL Developer.
>>>>>
>>>>>
>>>>> On Fri, Aug 26, 2011 at 2:36 PM, Damian<dfermin at umich.edu> wrote:
>>>>>> Hello.
>>>>>>
>>>>>>
>>>>>> I don't know how to debug this problem with the Core API in perl.
>>>>>>
>>>>>> Here is the code:
>>>>>> ####################################################
>>>>>> use Bio::EnsEMBL::Registry;
>>>>>>
>>>>>> my $reg = 'Bio::EnsEMBL::Registry';
>>>>>> $reg->load_registry_from_db(
>>>>>> -host => '127.0.0.1',
>>>>>> -user => 'nesviLab'
>>>>>> );
>>>>>>
>>>>>>
>>>>>> my $GA = $reg->get_adaptor('Human', 'Core', 'Gene');
>>>>>>
>>>>>> my $gene = $GA->fetch_by_stable_id('ENSG00000256461');
>>>>>>
>>>>>> my @exons = @{ $gene->get_all_Exons() };
>>>>>>
>>>>>> foreach my $e (@exons) {
>>>>>> print ">" . $e->stable_id() . "\n";
>>>>>> print $e->seq->seq . "\n\n";
>>>>>> }
>>>>>>
>>>>>> exit;
>>>>>>
>>>>>> ####################################################
>>>>>>
>>>>>>
>>>>>> When I run this code, the output is the first exon of the array and
>>>>>> that's
>>>>>> it:
>>>>>>> ENSE00002226834
>>>>>> The sequence of the exon is never written out.
>>>>>> The script does not throw an error and the program does exit.
>>>>>> Running 'top' on my computer shows that the script is not even using up
>>>>>> CPU
>>>>>> cycles.
>>>>>>
>>>>>> This only happens with genes on chromosome 1. The above code runs to
>>>>>> completion with any genes from chromosomes 2..Y
>>>>>> Any idea what's going on? Any and all help is greatly appreciated.
>>>>>>
>>>>>> I'm running the Ensembl Core version 62 on RHEL 5.4 (64bit).
>>>>>> Perl version: 5.8.8
>>>>>> MySQL version: 5.0.77
>>>>>>
>>>>>> Damian
>>>>>>
>>>>>> --
>>>>>>
>>>>>>
>>>>>> ------------------------------------------------------------------------------
>>>>>> Damian Fermin, Ph.D.
>>>>>> Pathology Department
>>>>>> University of Michigan
>>>>>> 4237 Medical Science I
>>>>>> 1301 Catherine
>>>>>> Ann Arbor, MI 48109-0602
>>>>>> 734.615.0302
>>>>>>
>>>>>> "There is No Gene for the Human Spirit"
>>>>>> -- GATTACA
>>>>>>
>>>>>>
>>>>>> ------------------------------------------------------------------------------
>>>>>>
>>>>>>
>>>>>> _______________________________________________
>>>>>> Dev mailing list Dev at ensembl.org
>>>>>> List admin (including subscribe/unsubscribe):
>>>>>> http://lists.ensembl.org/mailman/listinfo/dev
>>>>>> Ensembl Blog: http://www.ensembl.info/
>>>>>>
>>>> --
>>>>
>>>> ------------------------------------------------------------------------------
>>>> Damian Fermin, Ph.D.
>>>> Pathology Department
>>>> University of Michigan
>>>> 4237 Medical Science I
>>>> 1301 Catherine
>>>> Ann Arbor, MI 48109-0602
>>>> 734.615.0302
>>>>
>>>> "There is No Gene for the Human Spirit"
>>>> -- GATTACA
>>>>
>>>> ------------------------------------------------------------------------------
>>>>
>>>>
>> --
>> ------------------------------------------------------------------------------
>> Damian Fermin, Ph.D.
>> Pathology Department
>> University of Michigan
>> 4237 Medical Science I
>> 1301 Catherine
>> Ann Arbor, MI 48109-0602
>> 734.615.0302
>>
>> "There is No Gene for the Human Spirit"
>> -- GATTACA
>> ------------------------------------------------------------------------------
>>
>>
>
--
------------------------------------------------------------------------------
Damian Fermin, Ph.D.
Pathology Department
University of Michigan
4237 Medical Science I
1301 Catherine
Ann Arbor, MI 48109-0602
734.615.0302
"There is No Gene for the Human Spirit"
-- GATTACA
------------------------------------------------------------------------------
More information about the Dev
mailing list