[ensembl-dev] Core API quits with no error messages

[Damian]

I changed the registry settings to point it to ensembldb.ensembl.org and 
Version 62 worked. I got the same things you did.
I set the registry settings back to our local host and the problem 
reappeared.

So should I reinstall the API or reinstall version 62 core?

Damian


On 08/26/2011 10:39 AM, ian Longden wrote:
> Change 63 to 62.
> I did this and got:-
>
>> ENSE00002226834
> CTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCACCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACG
>
>> ENSE00002270664
> CAACAGTGCGCCCGGGGGGCCTGACCCCGACCACCGCATATACCAGCAAAGATGCGCCCGGGGGCCTGACCCCGACCACCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCACCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAAAGGTGCGCCCGGGGGCCT
>
>> ENSE00002216223
> CAACGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAACGGTGCGCCCGGGGGCCTGACCCCGACCCCCGCATATACCAGCAAAG
>
>
> I am guessing you have 62 version of the API installed, in which case
> if you do not set a db_version, you will automatically load the 62
> databases.
>
> So try two things 1) connect to our server to see if that works okay
>                            2) connect to your local copy and see if it works
>
> This will hopefully tell us if there is a problem with your local copy
> or wether the API is wrong at your end.
>
> -Ian.
>
>
> -Ian
>
>
>
> On Fri, Aug 26, 2011 at 3:27 PM, Damian<dfermin at umich.edu>  wrote:
>> Hi Ian.
>> Thanks for the quick reply.
>>
>> I'm using Ensembl Human Core 62_37g.
>>
>> We have to stick to this version because all our previous work was done with
>> it.
>>
>> Your code changes do indeed work but only with the 63 release.
>> Is there a way to identify these problem cases in 62 and to skip them?
>>
>> if(defined($gene)) doesn't work for me since the gene object is indeed
>> returned.
>>
>> Damian
>>
>>
>>
>> On 08/26/2011 10:16 AM, ian Longden wrote:
>>> What version of the API are you using?
>>> ENSG00000256461 has been archived and is not in release 63 so that
>>> could be part of it.
>>>
>>> also add -verbose =>    1 to the load_registry_form_db to see which
>>> databases it is connecting to.
>>>
>>> So i modified your script to use our server as a test
>>> #######################################################
>>> use Bio::EnsEMBL::Registry;
>>>
>>> my $reg = 'Bio::EnsEMBL::Registry';
>>>
>>> $reg->load_registry_from_db(
>>>         -host =>    'ensembldb.ensembl.org',
>>>         -user =>    'anonymous',
>>>         -db_version =>    63,
>>>         -verbose =>    1
>>> );
>>>
>>>
>>> my $GA = $reg->get_adaptor('Human', 'Core', 'Gene');
>>>
>>> my $gene = $GA->fetch_by_stable_id('ENSG00000256461');
>>>
>>> if(defined($gene)){
>>>
>>>    my @exons = @{ $gene->get_all_Exons() };
>>>
>>>    foreach my $e (@exons) {
>>>      print ">" . $e->stable_id() . "\n";
>>>      print $e->seq->seq . "\n\n";
>>>    }
>>> }
>>> else{
>>>    print "Gene could not be found\n";
>>> }
>>>
>>> exit;
>>> ##################################################################
>>> which gave me the list of databases and also the message:-
>>> Gene could not be found
>>>
>>> -Ian Longden
>>> EnsEMBL Developer.
>>>
>>>
>>> On Fri, Aug 26, 2011 at 2:36 PM, Damian<dfermin at umich.edu>    wrote:
>>>> Hello.
>>>>
>>>>
>>>> I don't know how to debug this problem with the Core API in perl.
>>>>
>>>> Here is the code:
>>>> ####################################################
>>>> use Bio::EnsEMBL::Registry;
>>>>
>>>> my $reg = 'Bio::EnsEMBL::Registry';
>>>> $reg->load_registry_from_db(
>>>>         -host =>    '127.0.0.1',
>>>>         -user =>    'nesviLab'
>>>> );
>>>>
>>>>
>>>> my $GA = $reg->get_adaptor('Human', 'Core', 'Gene');
>>>>
>>>> my $gene = $GA->fetch_by_stable_id('ENSG00000256461');
>>>>
>>>> my @exons = @{ $gene->get_all_Exons() };
>>>>
>>>> foreach my $e (@exons) {
>>>>     print ">" . $e->stable_id() . "\n";
>>>>     print $e->seq->seq . "\n\n";
>>>> }
>>>>
>>>> exit;
>>>>
>>>> ####################################################
>>>>
>>>>
>>>> When I run this code, the output is the first exon of the array and
>>>> that's
>>>> it:
>>>>> ENSE00002226834
>>>> The sequence of the exon is never written out.
>>>> The script does not throw an error and the program does exit.
>>>> Running 'top' on my computer shows that the script is not even using up
>>>> CPU
>>>> cycles.
>>>>
>>>> This only happens with genes on chromosome 1. The above code runs to
>>>> completion with any genes from chromosomes 2..Y
>>>> Any idea what's going on? Any and all help is greatly appreciated.
>>>>
>>>> I'm running the Ensembl Core version 62 on RHEL 5.4 (64bit).
>>>> Perl version: 5.8.8
>>>> MySQL version: 5.0.77
>>>>
>>>> Damian
>>>>
>>>> --
>>>>
>>>> ------------------------------------------------------------------------------
>>>> Damian Fermin, Ph.D.
>>>> Pathology Department
>>>> University of Michigan
>>>> 4237 Medical Science I
>>>> 1301 Catherine
>>>> Ann Arbor, MI 48109-0602
>>>> 734.615.0302
>>>>
>>>> "There is No Gene for the Human Spirit"
>>>>         -- GATTACA
>>>>
>>>> ------------------------------------------------------------------------------
>>>>
>>>>
>>>> _______________________________________________
>>>> Dev mailing list    Dev at ensembl.org
>>>> List admin (including subscribe/unsubscribe):
>>>> http://lists.ensembl.org/mailman/listinfo/dev
>>>> Ensembl Blog: http://www.ensembl.info/
>>>>
>> --
>> ------------------------------------------------------------------------------
>> Damian Fermin, Ph.D.
>> Pathology Department
>> University of Michigan
>> 4237 Medical Science I
>> 1301 Catherine
>> Ann Arbor, MI 48109-0602
>> 734.615.0302
>>
>> "There is No Gene for the Human Spirit"
>>         -- GATTACA
>> ------------------------------------------------------------------------------
>>
>>
>

-- 
------------------------------------------------------------------------------
Damian Fermin, Ph.D.
Pathology Department
University of Michigan
4237 Medical Science I
1301 Catherine
Ann Arbor, MI 48109-0602
734.615.0302

"There is No Gene for the Human Spirit"
	-- GATTACA
------------------------------------------------------------------------------