[ensembl-dev] get sequence from different build
Jan-hinnerk Vogel
jhv at sanger.ac.uk
Thu Sep 16 14:30:46 BST 2010
Hi Stef,
ooops - it seems the tutorial is wrong, sorry. We'll correct it asap.
What happend is that the 'strand' argument, which should be the 5th
argument, slipped somehow.
The assembly version should be the 6th argument, not the 5th. A good
way to get warned about
those things is to use perl -w or use 'use warnings' in your script -
you see something like
"Argument "GRCh37" isn't numeric in integer multiplication (*) at /nfs/
ensembl/jhv//cvs_checkout//ensembl_live/modules/Bio/EnsEMBL/Mapper.pm
line 314." so something is wrong ...
http://www.ensembl.org/info/docs/Pdoc/ensembl/modules/Bio/EnsEMBL/DBSQL/SliceAdaptor.html#POD15
You currently can't fetch sequence data from a different assembly
version from the same database - only the mapping is stored,
not the sequence of older assemblies. If you try it, you should get a
string of NNNNN's back.
To fetch sequence for GRCh37 use the latest human core :
homo_sapiens_core_59_37d
to fetch seq for NCBI36 you have to use an older database and connect
with an older API checkout - ie homo_sapiens_core_***_36*
Hth,
Jan-Hinnerk Vogel
==
Ensembl Genebuild Team Project Leader
www.ensembl.org
On 16 Sep 2010, at 12:54, mailsvl at fastmail.fm wrote:
> Hi,
>
> How can I get a slice from a different build then the default? When I
> try to compare GCRh37 and NCBI36 I keep getting the same sequences
> (from
> GCRh37), no matter what region I try.
I assume you mean i "GRCh37" ?
>
> The code I use is from:
> http://www.ensembl.org/info/docs/api/core/core_tutorial.html
>
> Code:
> - $slice_adaptor->fetch_by_region( 'chromosome', '11', 123000000,
> 123000020, 'NCBI36' ); or
> - $slice_adaptor->fetch_by_region( 'chromosome', '11', 123000000,
> 123000020, 1, 'NCBI36' );
>
> Results when using ensembl website:
>> 11 dna:chromosome chromosome:NCBI36:11:123000000:123000020:1
> AAGAGTCCCACCAGCTCCAGG
>> 11 dna:chromosome chromosome:GRCh37:11:123000000:123000020:1
> TGCACTCCAGCCTGGGCAATG
>
> Thanks,
> Stef
> __________________
> http://www.fastmail.fm
>
>
> _______________________________________________
> Dev mailing list
> Dev at ensembl.org
> http://lists.ensembl.org/mailman/listinfo/dev
-------------- next part --------------
A non-text attachment was scrubbed...
Name: smime.p7s
Type: application/pkcs7-signature
Size: 2063 bytes
Desc: not available
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20100916/bb077cf9/attachment.p7s>
More information about the Dev
mailing list