[ensembl-dev] Fwd: Possible bug in variation API - result different from VEP

[Bhavana Harsha]

Hi Will,

Thank you for looking into this.
You’re right, I do get the correct AA syntax with release 89.

I had tried to switch my git branches from an older version to 89, it must not have worked correctly. It worked when I did a fresh clone of the git repos. Sorry, my bad!

Cheers,
Bhavana


On 13 Jul 2017, at 12:00, dev-request at ensembl.org<mailto:dev-request at ensembl.org> wrote:

Message: 1
Date: Wed, 12 Jul 2017 12:44:53 +0100
From: William McLaren <wm2 at ebi.ac.uk<mailto:wm2 at ebi.ac.uk>>
To: Ensembl developers list <dev at ensembl.org<mailto:dev at ensembl.org>>
Subject: Re: [ensembl-dev] Fwd: Possible bug in variation API - result
different from VEP
Message-ID: <etPan.59660bb5.559a1909.ab7b at ebi.ac.uk<mailto:etPan.59660bb5.559a1909.ab7b at ebi.ac.uk>>
Content-Type: text/plain; charset="utf-8"

Hi Bhavana,

I?m unable to replicate this issue. I?ve run your code (slightly modified to dump out the results, exact code at the end of this mail), and this is the result I see:

$VAR1 = [
? 'ENSP00000352610.4:p.Ala307ThrfsTer41',
? 'ENSP00000269305.4:p.Ala307ThrfsTer34',
? 'ENSP00000398846.2:p.Ala307ThrfsTer32',
? 'ENSP00000391127.2:p.Ala307ThrfsTer40',
? 'ENSP00000391478.2:p.Ala307ThrfsTer34',
? 'ENSP00000425104.1:p.Ala175ThrfsTer?'
];

Double check that your API (both ensembl and ensembl-variation) is up to date for release/89.

Regards

Will McLaren
Ensembl Variation


###
use Bio::EnsEMBL::Registry;

my $reg = 'Bio::EnsEMBL::Registry';

$reg->load_registry_from_db(-host => 'ensembldb.ensembl.org<http://ensembldb.ensembl.org/>', -species => 'homo sapiens', -user => 'anonymous', -port => 3337, -db_version => 89);
my $sa = $reg->get_adaptor('human', 'core', 'slice');
my $vfa = $reg->get_adaptor('human', 'variation', 'VariationFeature');
my $slice = $sa->fetch_by_region('chromosome', 17);
my $vf = Bio::EnsEMBL::Variation::VariationFeature->new(-start => 7576915, -end => 7577019, -slice => $slice,
-allele_string => 'TGTTGGGCAGTGCTAGGAAAGAGGCAAGGAAAGGTGATAAAAGTGAATCTGAGGCATAACTGCACCCTTGGTCTCCTCCACCGCTTCTTGTCCTGCTTGCTTACC/-', -strand => 1, -adaptor => $vfa);
my $cons = $vf->get_all_TranscriptVariations;
my @hgvsp = grep { defined } map { $_->hgvs_protein } map { @{$_->get_all_alternate_TranscriptVariationAlleles} } @$cons;

use Data::Dumper;
$Data::Dumper::Maxdepth = 3;
$Data::Dumper::Indent = 1;
print STDERR Dumper \@hgvsp;

On 11 July 2017 at 15:24:39, Bhavana Harsha (bh4 at sanger.ac.uk<mailto:bh4 at sanger.ac.uk>) wrote:

I forgot to mention that these are GRCh37 coordinates.

Bhavana

Begin forwarded message:

From: Bhavana Harsha <bh4 at sanger.ac.uk<mailto:bh4 at sanger.ac.uk>>
Subject: Possible bug in variation API - result different from VEP
Date: 11 July 2017 at 14:17:20 BST
To: dev at ensembl.org<mailto:dev at ensembl.org>

Hello,?

For the following variant
17 75769157577019 TGTTGGGCAGTGCTAGGAAAGAGGCAAGGAAAGGTGATAAAAGTGAATCTGAGGCATAACTGCACCCTTGGTCTCCTCCACCGCTTCTTGTCCTGCTTGCTTACC/-+

the correct protein consequence for the transcript ENST00000269305 should be?
ENSP00000269305.4:p.Ala307ThrfsTer34

As is confirmed by the VEP web interface, REST API and the VEP perl script.


However, when I try to get this using the Variation API, I get
ENSP00000269305.4:p.Ala307Thr

This is how I?m using the API:

$reg->load_registry_from_db(-host => 'ensembldb.ensembl.org<http://ensembldb.ensembl.org/>', -species => 'homo sapiens', -user => 'anonymous', -port => 3337);
my $sa = $reg->get_adaptor(?human?, 'core', 'slice');
my $vfa = $reg->get_adaptor('human', 'variation', 'VariationFeature');
my $slice = $sa->fetch_by_region(?chromosome', 17);
my $vf = Bio::EnsEMBL::Variation::VariationFeature->new(-start => 7576915,?-end => 7577019,?-slice => $slice,?
-allele_string => ?TGTTGGGCAGTGCTAGGAAAGAGGCAAGGAAAGGTGATAAAAGTGAATCTGAGGCATAACTGCACCCTTGGTCTCCTCCACCGCTTCTTGTCCTGCTTGCTTACC/-?,?-strand => 1,?-adaptor => $vfa);
my $cons = $vf->get_all_TranscriptVariations;
my @hgvsp = grep { defined } map { $_->hgvs_protein } map { @{$_->get_all_alternate_TranscriptVariationAlleles} } @$cons;


I?m using v89 for the API and the VEP script.

Is there something I?m doing wrong in my script?


Cheers,
Bhavana




---------------------------------------------
Bhavana Harsha
Bioinformatician
COSMIC
Wellcome Trust Sanger Institute
Hinxton, UK
CB10 1SA


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20170713/4b4d8ac4/attachment.html>