[ensembl-dev] 1-based coordinate system Vs 0-based coordinate system

[Duarte Molha]

Dear Developers

I was wondering if you could give me a quick explanation on this.

I am aware that ensembl uses 1-based coordinate system and UCSC uses
0-based...

However... consider this sequence:

ctaagccacaccataactgacttctaggcattcatctttcttccacttaaattcattctc

When I blated this sequence, both UCSC and Ensembl blat servers gave be the
exact same coordinate for the hit:

chr14:79498951-79499010

However I would expect, if I put this exact coordinates in ensembl browser
and in UCSC genome browser the sequence retrieved would be trimmed by one
base in ENSEMBL.

However this is not the case. Can you explain me why this is?

I am sure you probably have already explained this before so I apologize
beforehand if this is a dumb question.

Best regards

Duarte
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mail.ensembl.org/pipermail/dev_ensembl.org/attachments/20131213/c858b0c1/attachment.html>